Review



sirnas against tip60  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Santa Cruz Biotechnology sirnas against tip60
    <t>Tip60</t> is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia. ( A ) HEK293T cells were transfected with multiple HA- or Flag-tagged acetyltransferases or HA empty vector as indicated for 48 h under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were transfected with Flag-tagged wild-type Tip60 (Flag-Tip60), the dominant negative (DN) mutant lacking the enzymatic activity of Tip60 (Flag-Tip60-DN), or Flag empty vector for 48 h under normoxic conditions. Cells were then treated with or without 30 μM MG149 for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( C ) HEK293T cells were transfected with Flag-Tip60, Flag-Tip60-DN, or Flag empty vector for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were cultured under normoxic or hypoxic conditions for 24 h. WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were cultured under normoxic conditions. Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( F ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp). Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp) or not (Nor). Cells were then treated with or without 25 μM MG132 for another 12 h. Co-IP assays were performed with anti-β-TrCP1 antibodies followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( H ) GST-tagged Tip60 (GST-Tip60) and His6-tagged β-TrCP1 (His6-β-TrCP1) were purified from E. coli (left) and coincubated. His6 or GST pull-down analysis with Ni-beads or Sepharose 4B-beads was performed (right two panels). ( I ) In vitro acetylation assays were performed by incubating GST-Tip60 and His6-β-TrCP1 with or without acetyl coenzyme A (Ac-CoA). WB assays were performed with the indicated antibodies. ( J ) HEK293T cells transfected with HA-tagged β-TrCP1 (HA-β-TrCP1) together with Flag-Tip60 or Flag-Tip60-DN were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) together with Tip60-specific siRNA (siTip60: (+)) or control siRNA (siTip60: (-)) were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-Flag antibodies followed by WB analyses. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells were transfected with siTip60 or siCont. for 48 h. Cells were then treated with or without 25 μM MG132 and cultured under normoxic or hypoxic conditions for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with Flag-Tip60 or Flag empty vector for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) HEK293T cells were transfected with siTip60 or siCont. for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia
    Sirnas Against Tip60, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tip60+sirna/pmc12799899-401-1-33?v=Santa+Cruz+Biotechnology
    Average 93 stars, based on 13 article reviews
    sirnas against tip60 - by Bioz Stars, 2026-07
    93/100 stars

    Images

    1) Product Images from "Tip60-HDAC8-SMURF2-mediated β-TrCP1 degradation is a key mechanism for hypoxia-induced cell death and tissue injury"

    Article Title: Tip60-HDAC8-SMURF2-mediated β-TrCP1 degradation is a key mechanism for hypoxia-induced cell death and tissue injury

    Journal: Cellular and Molecular Life Sciences: CMLS

    doi: 10.1007/s00018-025-05983-4

    Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia. ( A ) HEK293T cells were transfected with multiple HA- or Flag-tagged acetyltransferases or HA empty vector as indicated for 48 h under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were transfected with Flag-tagged wild-type Tip60 (Flag-Tip60), the dominant negative (DN) mutant lacking the enzymatic activity of Tip60 (Flag-Tip60-DN), or Flag empty vector for 48 h under normoxic conditions. Cells were then treated with or without 30 μM MG149 for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( C ) HEK293T cells were transfected with Flag-Tip60, Flag-Tip60-DN, or Flag empty vector for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were cultured under normoxic or hypoxic conditions for 24 h. WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were cultured under normoxic conditions. Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( F ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp). Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp) or not (Nor). Cells were then treated with or without 25 μM MG132 for another 12 h. Co-IP assays were performed with anti-β-TrCP1 antibodies followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( H ) GST-tagged Tip60 (GST-Tip60) and His6-tagged β-TrCP1 (His6-β-TrCP1) were purified from E. coli (left) and coincubated. His6 or GST pull-down analysis with Ni-beads or Sepharose 4B-beads was performed (right two panels). ( I ) In vitro acetylation assays were performed by incubating GST-Tip60 and His6-β-TrCP1 with or without acetyl coenzyme A (Ac-CoA). WB assays were performed with the indicated antibodies. ( J ) HEK293T cells transfected with HA-tagged β-TrCP1 (HA-β-TrCP1) together with Flag-Tip60 or Flag-Tip60-DN were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) together with Tip60-specific siRNA (siTip60: (+)) or control siRNA (siTip60: (-)) were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-Flag antibodies followed by WB analyses. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells were transfected with siTip60 or siCont. for 48 h. Cells were then treated with or without 25 μM MG132 and cultured under normoxic or hypoxic conditions for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with Flag-Tip60 or Flag empty vector for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) HEK293T cells were transfected with siTip60 or siCont. for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia
    Figure Legend Snippet: Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia. ( A ) HEK293T cells were transfected with multiple HA- or Flag-tagged acetyltransferases or HA empty vector as indicated for 48 h under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were transfected with Flag-tagged wild-type Tip60 (Flag-Tip60), the dominant negative (DN) mutant lacking the enzymatic activity of Tip60 (Flag-Tip60-DN), or Flag empty vector for 48 h under normoxic conditions. Cells were then treated with or without 30 μM MG149 for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( C ) HEK293T cells were transfected with Flag-Tip60, Flag-Tip60-DN, or Flag empty vector for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were cultured under normoxic or hypoxic conditions for 24 h. WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were cultured under normoxic conditions. Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( F ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp). Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp) or not (Nor). Cells were then treated with or without 25 μM MG132 for another 12 h. Co-IP assays were performed with anti-β-TrCP1 antibodies followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( H ) GST-tagged Tip60 (GST-Tip60) and His6-tagged β-TrCP1 (His6-β-TrCP1) were purified from E. coli (left) and coincubated. His6 or GST pull-down analysis with Ni-beads or Sepharose 4B-beads was performed (right two panels). ( I ) In vitro acetylation assays were performed by incubating GST-Tip60 and His6-β-TrCP1 with or without acetyl coenzyme A (Ac-CoA). WB assays were performed with the indicated antibodies. ( J ) HEK293T cells transfected with HA-tagged β-TrCP1 (HA-β-TrCP1) together with Flag-Tip60 or Flag-Tip60-DN were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) together with Tip60-specific siRNA (siTip60: (+)) or control siRNA (siTip60: (-)) were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-Flag antibodies followed by WB analyses. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells were transfected with siTip60 or siCont. for 48 h. Cells were then treated with or without 25 μM MG132 and cultured under normoxic or hypoxic conditions for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with Flag-Tip60 or Flag empty vector for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) HEK293T cells were transfected with siTip60 or siCont. for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia

    Techniques Used: Transfection, Plasmid Preparation, Dominant Negative Mutation, Mutagenesis, Activity Assay, Cell Culture, Co-Immunoprecipitation Assay, Negative Control, Purification, In Vitro, Control

    K96 and K294 are the acetylation sites of β-TrCP1 that are regulated by Tip60 and HDAC8 and are responsible for hypoxia-induced β-TrCP1 degradation. ( A ) LC–MS/MS analysis of Flag-tagged β-TrCP1 identified K96, K220, and K294 as potential β-TrCP1 acetylation sites. MS spectra of the peptides containing the three acetylation sites are shown. ( B ) Prediction of potential acetylation sites of β-TrCP1 using the GPS-PAIL database ( http://pail.biocuckoo.org/ ). ( C ) HEK293T cells transfected with Flag-tagged wild-type (WT) β-TrCP1 or seven lysine (K) to alanine (A)-mutated β-TrCP1 were challenged with 1% O 2 for 24 h (Hyp) or not (Nor) combined with (+) or without (-) 10 μM TSA for 12 h as indicated. WB assays were performed with the indicated antibodies. ( D ) HEK293T cells were transfected with Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( E ) Alignment of the K96- and K294-containing peptide sequences from distinct species. ( F ) Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 combined with (+) or without (-) HA-tagged Tip60 (HA-Tip60) as indicated was transfected into HEK293T cells for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( G ) Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 combined with (+) or without (-) HDAC8-specific siRNA (siHDAC8) as indicated was transfected into HEK293T cells for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( H ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (Flag-β-TrCP1-WT) or K96A- or K294A-mutated β-TrCP1 (Flag-β-TrCP1-K96A and Flag-β-TrCP1-K294A) for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( I ) K to glutamine (Q) mutations at the K96 and K294 sites of β-TrCP1 were generated. HEK293T cells were transfected with Flag-β-TrCP1-WT, Flag-tagged K96Q- or K294Q-mutated β-TrCP1 (Flag-β-TrCP1-K96Q and Flag-β-TrCP1-K294Q) for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( J ) HEK293T cells were transfected with WT or K96A-, K294A-, K96Q-, or K294Q-mutated Flag-β-TrCP1 for 48 h. Cells were then cultured under hypoxic conditions (Hyp) for 24 h combined with 25 μM MG132 treatment for 12 h. Cells were subsequently lysed under denaturing conditions, and β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analysis. ( K ) HEK293T cells transfected with WT or K96A-, K294A-, K96Q-, or K294Q-, or double KA- or KQ-mutated Flag-β-TrCP1 were challenged with 1% O 2 for 24 h (Hyp) or not (Nor) as indicated. WB assays were performed to measure the levels of the indicated proteins. ( L ) WT or K96A-, K2 22 94A-, or double KA-mutated Flag-β-TrCP1 together with (+) or without (-) siHDAC8 were transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor) as indicated. WB assays were performed to measure the levels of the indicated proteins. ( M ) WT or seven KA-mutated Flag-β-TrCP1 together with (+) or without (-) HA-Tip60 were transfected into HEK293T cells under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( N) WT or K96A- or K294A-mutated Flag-β-TrCP1 together with (+) or without (-) HA-Tip60 were transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp). WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 mainly regulates the acetylation of β-TrCP1 at K294, whereas HDAC8 can eliminate the acetylation of β-TrCP1 at both K96 and K294
    Figure Legend Snippet: K96 and K294 are the acetylation sites of β-TrCP1 that are regulated by Tip60 and HDAC8 and are responsible for hypoxia-induced β-TrCP1 degradation. ( A ) LC–MS/MS analysis of Flag-tagged β-TrCP1 identified K96, K220, and K294 as potential β-TrCP1 acetylation sites. MS spectra of the peptides containing the three acetylation sites are shown. ( B ) Prediction of potential acetylation sites of β-TrCP1 using the GPS-PAIL database ( http://pail.biocuckoo.org/ ). ( C ) HEK293T cells transfected with Flag-tagged wild-type (WT) β-TrCP1 or seven lysine (K) to alanine (A)-mutated β-TrCP1 were challenged with 1% O 2 for 24 h (Hyp) or not (Nor) combined with (+) or without (-) 10 μM TSA for 12 h as indicated. WB assays were performed with the indicated antibodies. ( D ) HEK293T cells were transfected with Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( E ) Alignment of the K96- and K294-containing peptide sequences from distinct species. ( F ) Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 combined with (+) or without (-) HA-tagged Tip60 (HA-Tip60) as indicated was transfected into HEK293T cells for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( G ) Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 combined with (+) or without (-) HDAC8-specific siRNA (siHDAC8) as indicated was transfected into HEK293T cells for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( H ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (Flag-β-TrCP1-WT) or K96A- or K294A-mutated β-TrCP1 (Flag-β-TrCP1-K96A and Flag-β-TrCP1-K294A) for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( I ) K to glutamine (Q) mutations at the K96 and K294 sites of β-TrCP1 were generated. HEK293T cells were transfected with Flag-β-TrCP1-WT, Flag-tagged K96Q- or K294Q-mutated β-TrCP1 (Flag-β-TrCP1-K96Q and Flag-β-TrCP1-K294Q) for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( J ) HEK293T cells were transfected with WT or K96A-, K294A-, K96Q-, or K294Q-mutated Flag-β-TrCP1 for 48 h. Cells were then cultured under hypoxic conditions (Hyp) for 24 h combined with 25 μM MG132 treatment for 12 h. Cells were subsequently lysed under denaturing conditions, and β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analysis. ( K ) HEK293T cells transfected with WT or K96A-, K294A-, K96Q-, or K294Q-, or double KA- or KQ-mutated Flag-β-TrCP1 were challenged with 1% O 2 for 24 h (Hyp) or not (Nor) as indicated. WB assays were performed to measure the levels of the indicated proteins. ( L ) WT or K96A-, K2 22 94A-, or double KA-mutated Flag-β-TrCP1 together with (+) or without (-) siHDAC8 were transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor) as indicated. WB assays were performed to measure the levels of the indicated proteins. ( M ) WT or seven KA-mutated Flag-β-TrCP1 together with (+) or without (-) HA-Tip60 were transfected into HEK293T cells under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( N) WT or K96A- or K294A-mutated Flag-β-TrCP1 together with (+) or without (-) HA-Tip60 were transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp). WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 mainly regulates the acetylation of β-TrCP1 at K294, whereas HDAC8 can eliminate the acetylation of β-TrCP1 at both K96 and K294

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Transfection, Co-Immunoprecipitation Assay, Negative Control, Generated, Cell Culture, Immunoprecipitation

    SMURF2 is the E3 ubiquitin ligase for β-TrCP1 and is essential for hypoxia-induced β-TrCP1 degradation. ( A ) HEK293T cells were transfected with control siRNA (siCont.) or siRNAs specific for the indicated genes for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( B ) Myc-tagged wild-type (WT) SMURF2 or Myc-tagged C716A-mutated SMURF2 lacking enzymatic activity or Myc empty vector was transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( C ) Myc-tagged SMURF2 or Myc empty vector was transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor) and treated with (+) or without (-) 25 μM MG132 for 12 h. WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) and Myc-SMURF2 for 48 h. Cells were challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( E ) Flag-β-TrCP1 and His-tagged ubiquitin (His-ubiquitin) were cotransfected with or without Myc-SMURF2 into HEK293T cells for 48 h. Cells were then treated with 25 mM MG132 and cultured under normoxic or hypoxic conditions for another 24 h. Cells were lysed under denaturing conditions, and Flag-β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analyses. ( F ) Flag-β-TrCP1 and His-ubiquitin were cotransfected with or without SMURF2-specific siRNA (siSMURF2) into HEK293T cells for 48 h. Cells were then treated with 25 mM MG132 and cultured under normoxic or hypoxic conditions for another 24 h. Cells were lysed under denaturing conditions, and Flag-β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analyses. ( G and H ) HEK293T cells were transfected with Myc-SMURF2 or Myc empty vector for 48 h. Cells were cultured under normoxic or hypoxic conditions for another 24 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( I and J ) HEK293T cells were transfected with siSMURF2 or control siRNA (siCont.) for 48 h. Cells were cultured under normoxic or hypoxic conditions for another 24 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( K ) HEK293T cells transfected with Flag-β-TrCP1 and Myc-SMURF2 combined with (+) or without (-) siHDAC8 were challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells transfected with Flag-β-TrCP1 and Myc-SMURF2 combined with (+) or without (-) HA-Tip60 were challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( M ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (WT) or Flag-tagged K96A- or K294A-mutated β-TrCP1 (K96A- or K294A) combined with Myc-SMURF2 for 48 h. Cells were then challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( N ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (WT) or Flag-tagged K96Q- or K294Q-mutated β-TrCP1 (K96Q- or K294Q) combined with Myc-SMURF2 for 48 h. Cells were then challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( O ) WT or the K96Q- or K294Q-mutated Flag-β-TrCP1 together with (+) or without (-) Myc-tagged SMURF2 (Myc-SMURF2) were transfected into HEK293T cells for 24 h. Cells were then exposed to 1% O 2 for 12 h (Hyp) or not (Nor). Cell extracts were prepared, and WB assays were performed to measure the levels of the indicated proteins. ( P ) WT or K96A- or K294A-mutated Flag-β-TrCP1 together with (+) or without (-) Myc-tagged SMURF2 (Myc-SMURF2) were transfected into HEK293T cells for 24 h. Cells were then exposed to 1% O 2 for 12 h (Hyp) or not (Nor). Cell extracts were prepared, and WB assays were performed to measure the levels of the indicated proteins
    Figure Legend Snippet: SMURF2 is the E3 ubiquitin ligase for β-TrCP1 and is essential for hypoxia-induced β-TrCP1 degradation. ( A ) HEK293T cells were transfected with control siRNA (siCont.) or siRNAs specific for the indicated genes for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( B ) Myc-tagged wild-type (WT) SMURF2 or Myc-tagged C716A-mutated SMURF2 lacking enzymatic activity or Myc empty vector was transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( C ) Myc-tagged SMURF2 or Myc empty vector was transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor) and treated with (+) or without (-) 25 μM MG132 for 12 h. WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) and Myc-SMURF2 for 48 h. Cells were challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( E ) Flag-β-TrCP1 and His-tagged ubiquitin (His-ubiquitin) were cotransfected with or without Myc-SMURF2 into HEK293T cells for 48 h. Cells were then treated with 25 mM MG132 and cultured under normoxic or hypoxic conditions for another 24 h. Cells were lysed under denaturing conditions, and Flag-β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analyses. ( F ) Flag-β-TrCP1 and His-ubiquitin were cotransfected with or without SMURF2-specific siRNA (siSMURF2) into HEK293T cells for 48 h. Cells were then treated with 25 mM MG132 and cultured under normoxic or hypoxic conditions for another 24 h. Cells were lysed under denaturing conditions, and Flag-β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analyses. ( G and H ) HEK293T cells were transfected with Myc-SMURF2 or Myc empty vector for 48 h. Cells were cultured under normoxic or hypoxic conditions for another 24 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( I and J ) HEK293T cells were transfected with siSMURF2 or control siRNA (siCont.) for 48 h. Cells were cultured under normoxic or hypoxic conditions for another 24 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( K ) HEK293T cells transfected with Flag-β-TrCP1 and Myc-SMURF2 combined with (+) or without (-) siHDAC8 were challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells transfected with Flag-β-TrCP1 and Myc-SMURF2 combined with (+) or without (-) HA-Tip60 were challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( M ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (WT) or Flag-tagged K96A- or K294A-mutated β-TrCP1 (K96A- or K294A) combined with Myc-SMURF2 for 48 h. Cells were then challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( N ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (WT) or Flag-tagged K96Q- or K294Q-mutated β-TrCP1 (K96Q- or K294Q) combined with Myc-SMURF2 for 48 h. Cells were then challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( O ) WT or the K96Q- or K294Q-mutated Flag-β-TrCP1 together with (+) or without (-) Myc-tagged SMURF2 (Myc-SMURF2) were transfected into HEK293T cells for 24 h. Cells were then exposed to 1% O 2 for 12 h (Hyp) or not (Nor). Cell extracts were prepared, and WB assays were performed to measure the levels of the indicated proteins. ( P ) WT or K96A- or K294A-mutated Flag-β-TrCP1 together with (+) or without (-) Myc-tagged SMURF2 (Myc-SMURF2) were transfected into HEK293T cells for 24 h. Cells were then exposed to 1% O 2 for 12 h (Hyp) or not (Nor). Cell extracts were prepared, and WB assays were performed to measure the levels of the indicated proteins

    Techniques Used: Ubiquitin Proteomics, Transfection, Control, Activity Assay, Plasmid Preparation, Co-Immunoprecipitation Assay, Negative Control, Cell Culture, Immunoprecipitation

    Tip60 is prolyl-hydroxylated and stabilized by PHD2. ( A ) HEK293T cells were treated with 300 μM CoCl 2 (left) or 20 μM IOX2 (right) for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were treated with 300 μM CoCl 2 (upper) or 20 μM IOX2 (lower) for 12 h. Quantitative RT-PCR assays were performed to detect the mRNA levels of Tip60 and β-TrCP1. ( C ) HEK293T cells were treated with 300 μM CoCl 2 or 20 μM IOX2 together with or without 25 μM MG132 for 12 h. WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were transfected with increasing amounts of Flag-tagged PHD2 (Flag-PHD2) for 48 h. Cells were then exposed to 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were transfected with PHD2-specific siRNA (siPHD2) or control siRNA (siCont.) for 48 h. Cells were then exposed in 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to detect the levels of the indicated proteins. ( F ) HEK293T cells were transfected with Flag-PHD2 and HA-tagged Tip60 (HA-Tip60) for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag (upper) or anti-HA (lower) antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were transfected with HA-Tip60 combined with (+) or without (-) Flag-PHD2 or siPHD2 as indicated for 48 h under normoxic conditions. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( H ) HEK293T cells were transfected with Flag-tagged Tip60 (Flag-Tip60) for 48 h under normoxic conditions. Cells were then treated with 300 μM CoCl 2 or 20 μM IOX2 for the indicated times. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( I ) HEK293T cells were transfected with wild-type (WT) Flag-Tip60 and its eight P to alanine (A) mutants under normoxic conditions for 48 h. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( J ) WT or P159A- or P374A-mutated Flag-Tip60 were cotransfected with (+) or without (-) HA-tagged PHD2 (HA-PHD2) into HEK293T cells under normoxic conditions for 48 h. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells were transfected with siPHD2 or siCont. for 48 h. Cells were then cultured under normoxic (Nor) or hypoxic (Hyp) conditions for another 12 h together with or without 25 μM MG132 treatment as indicated. WB assays were performed to measure the levels of the indicated proteins. ( L ) HEK293T cells were transfected with Flag-PHD2 or Flag empty vector (upper) or siPHD2 or siCont. (lower) under normoxic conditions for 48 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with WT Flag-Tip60 (Flag-Tip60-WT) or P159A- or P374A-mutated Tip60 (Flag-Tip60-P159A and Flag-Tip60-P374A) under normoxic conditions for 48 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) Flag-Tip60-transfected HEK293T cells were challenged with 1% O 2 (Hyp) for the indicated times. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( O ) Working model. Tip60 is prolyl-hydroxylated and stabilized by PHD2 under normoxic conditions, whereas hypoxia decreases the prolyl hydroxylation of Tip60 and destabilizes Tip60
    Figure Legend Snippet: Tip60 is prolyl-hydroxylated and stabilized by PHD2. ( A ) HEK293T cells were treated with 300 μM CoCl 2 (left) or 20 μM IOX2 (right) for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were treated with 300 μM CoCl 2 (upper) or 20 μM IOX2 (lower) for 12 h. Quantitative RT-PCR assays were performed to detect the mRNA levels of Tip60 and β-TrCP1. ( C ) HEK293T cells were treated with 300 μM CoCl 2 or 20 μM IOX2 together with or without 25 μM MG132 for 12 h. WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were transfected with increasing amounts of Flag-tagged PHD2 (Flag-PHD2) for 48 h. Cells were then exposed to 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were transfected with PHD2-specific siRNA (siPHD2) or control siRNA (siCont.) for 48 h. Cells were then exposed in 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to detect the levels of the indicated proteins. ( F ) HEK293T cells were transfected with Flag-PHD2 and HA-tagged Tip60 (HA-Tip60) for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag (upper) or anti-HA (lower) antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were transfected with HA-Tip60 combined with (+) or without (-) Flag-PHD2 or siPHD2 as indicated for 48 h under normoxic conditions. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( H ) HEK293T cells were transfected with Flag-tagged Tip60 (Flag-Tip60) for 48 h under normoxic conditions. Cells were then treated with 300 μM CoCl 2 or 20 μM IOX2 for the indicated times. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( I ) HEK293T cells were transfected with wild-type (WT) Flag-Tip60 and its eight P to alanine (A) mutants under normoxic conditions for 48 h. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( J ) WT or P159A- or P374A-mutated Flag-Tip60 were cotransfected with (+) or without (-) HA-tagged PHD2 (HA-PHD2) into HEK293T cells under normoxic conditions for 48 h. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells were transfected with siPHD2 or siCont. for 48 h. Cells were then cultured under normoxic (Nor) or hypoxic (Hyp) conditions for another 12 h together with or without 25 μM MG132 treatment as indicated. WB assays were performed to measure the levels of the indicated proteins. ( L ) HEK293T cells were transfected with Flag-PHD2 or Flag empty vector (upper) or siPHD2 or siCont. (lower) under normoxic conditions for 48 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with WT Flag-Tip60 (Flag-Tip60-WT) or P159A- or P374A-mutated Tip60 (Flag-Tip60-P159A and Flag-Tip60-P374A) under normoxic conditions for 48 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) Flag-Tip60-transfected HEK293T cells were challenged with 1% O 2 (Hyp) for the indicated times. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( O ) Working model. Tip60 is prolyl-hydroxylated and stabilized by PHD2 under normoxic conditions, whereas hypoxia decreases the prolyl hydroxylation of Tip60 and destabilizes Tip60

    Techniques Used: Quantitative RT-PCR, Transfection, Control, Co-Immunoprecipitation Assay, Negative Control, Cell Culture, Plasmid Preparation

    β-TrCP1 degradation is required for hypoxia-induced cell death and tissue injury. ( A ) HepG2 cells were transfected with siHDAC8 or siHDAC8 combined with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( B ) HepG2 cells were transfected with Flag-Tip60 or Flag-Tip60 combined with siβ-TrCP1 or Flag empty vector for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( C ) HepG2 cells were transfected with wild-type (WT) or K96Q- or K294Q-mutated Flag-β-TrCP1 for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( D ) HepG2 cells were transfected with siSMURF2 or siSMUFR2 combined with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( E ) HepG2 cells were transfected with Flag-β-TrCP1 or Flag empty vector for 24 h. Cells were then exposed to 1% O 2 for 72 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( F ) HepG2 cells were transfected with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 for 72 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( G ) HepG2 cells were transfected with siβ-TrCP1, siβ-TrCP1 together with p53-specific siRNA (sip53), or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times or not (Nor). Cell death was measured by PI staining assay. ( H ) HepG2 cells were transfected with HA-tagged β-TrCP1 (HA-β-TrCP1), HA-β-TrCP1 together with Flag-tagged p53 (Flag-p53), or Flag empty vector (Cont.) for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times or not (Nor). Cell death was measured by PI staining assay. ( I ) Wild-type (WT), Tip60-specific shRNA (shTip60)-containing AAV8-infected or shTip60-AAV8 combined with Flag-β-TrCP1-containing AAV8-infected mice were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( J ) WT, shTip60-containing AAV8-infected or shTip60-AAV8 combined with Flag-β-TrCP1-containing AAV8-infected mice were exposed to Hyp for 72 h (+) or not (-) as indicated. Serum ALT and AST levels were measured ( n = 6). (K ) WT, β-TrCP1 −/− , and WT or β-TrCP1 −/− mice infected with HDAC8-specific shRNA (shHDAC8)-containing AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( L ) WT, β-TrCP1 −/− , and WT or β-TrCP1 −/− mice infected with shHDAC8-AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Serum ALT and AST levels were measured ( n = 6). ( M ) WT, β-TrCP1 −/− and β-TrCP1 −/− mice infected with p53-specific shRNA (shp53)-containing AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( N ) WT, β-TrCP1 −/− or β-TrCP1 −/− mice infected with shp53-containing AAV8 were exposed to Hyp for 72 h (+) or not (-) as indicated. Serum ALT, AST and bilirubin levels were measured ( n = 6). ( O ) Working model. Under normoxic conditions, Tip60 is prolyl-hydroxylated and stabilized by PHD2, and then Tip60 acetylates β-TrCP1 to stabilize β-TrCP1, allowing cells with lower levels of p53. Under hypoxic conditions, impaired prolyl hydroxylation of Tip60 results in the degradation of Tip60, and HDAC8 is recruited to β-TrCP1, synergistically promoting a decrease in β-TrCP1 acetylation. Thus, more SMURF2 is recruited to β-TrCP1 and ubiquitinates β-TrCP1 to promote its degradation. Ultimately, p53 is accumulated, and cell death occurs. Data information: Bars and error bars represent mean ± SD, n = 4 independent repeats in ( A - D and H ), n = 3 independent repeats in ( G ), n = 6 independent repeats in ( J and L ). Two-tailed unpaired Student’s t test was performed. * p < 0.05; ** p < 0.01; *** p < 0.001
    Figure Legend Snippet: β-TrCP1 degradation is required for hypoxia-induced cell death and tissue injury. ( A ) HepG2 cells were transfected with siHDAC8 or siHDAC8 combined with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( B ) HepG2 cells were transfected with Flag-Tip60 or Flag-Tip60 combined with siβ-TrCP1 or Flag empty vector for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( C ) HepG2 cells were transfected with wild-type (WT) or K96Q- or K294Q-mutated Flag-β-TrCP1 for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( D ) HepG2 cells were transfected with siSMURF2 or siSMUFR2 combined with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( E ) HepG2 cells were transfected with Flag-β-TrCP1 or Flag empty vector for 24 h. Cells were then exposed to 1% O 2 for 72 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( F ) HepG2 cells were transfected with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 for 72 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( G ) HepG2 cells were transfected with siβ-TrCP1, siβ-TrCP1 together with p53-specific siRNA (sip53), or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times or not (Nor). Cell death was measured by PI staining assay. ( H ) HepG2 cells were transfected with HA-tagged β-TrCP1 (HA-β-TrCP1), HA-β-TrCP1 together with Flag-tagged p53 (Flag-p53), or Flag empty vector (Cont.) for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times or not (Nor). Cell death was measured by PI staining assay. ( I ) Wild-type (WT), Tip60-specific shRNA (shTip60)-containing AAV8-infected or shTip60-AAV8 combined with Flag-β-TrCP1-containing AAV8-infected mice were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( J ) WT, shTip60-containing AAV8-infected or shTip60-AAV8 combined with Flag-β-TrCP1-containing AAV8-infected mice were exposed to Hyp for 72 h (+) or not (-) as indicated. Serum ALT and AST levels were measured ( n = 6). (K ) WT, β-TrCP1 −/− , and WT or β-TrCP1 −/− mice infected with HDAC8-specific shRNA (shHDAC8)-containing AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( L ) WT, β-TrCP1 −/− , and WT or β-TrCP1 −/− mice infected with shHDAC8-AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Serum ALT and AST levels were measured ( n = 6). ( M ) WT, β-TrCP1 −/− and β-TrCP1 −/− mice infected with p53-specific shRNA (shp53)-containing AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( N ) WT, β-TrCP1 −/− or β-TrCP1 −/− mice infected with shp53-containing AAV8 were exposed to Hyp for 72 h (+) or not (-) as indicated. Serum ALT, AST and bilirubin levels were measured ( n = 6). ( O ) Working model. Under normoxic conditions, Tip60 is prolyl-hydroxylated and stabilized by PHD2, and then Tip60 acetylates β-TrCP1 to stabilize β-TrCP1, allowing cells with lower levels of p53. Under hypoxic conditions, impaired prolyl hydroxylation of Tip60 results in the degradation of Tip60, and HDAC8 is recruited to β-TrCP1, synergistically promoting a decrease in β-TrCP1 acetylation. Thus, more SMURF2 is recruited to β-TrCP1 and ubiquitinates β-TrCP1 to promote its degradation. Ultimately, p53 is accumulated, and cell death occurs. Data information: Bars and error bars represent mean ± SD, n = 4 independent repeats in ( A - D and H ), n = 3 independent repeats in ( G ), n = 6 independent repeats in ( J and L ). Two-tailed unpaired Student’s t test was performed. * p < 0.05; ** p < 0.01; *** p < 0.001

    Techniques Used: Transfection, Staining, Plasmid Preparation, shRNA, Infection, TUNEL Assay, Immunostaining, Two Tailed Test



    Similar Products

    93
    Santa Cruz Biotechnology sirnas against tip60
    <t>Tip60</t> is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia. ( A ) HEK293T cells were transfected with multiple HA- or Flag-tagged acetyltransferases or HA empty vector as indicated for 48 h under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were transfected with Flag-tagged wild-type Tip60 (Flag-Tip60), the dominant negative (DN) mutant lacking the enzymatic activity of Tip60 (Flag-Tip60-DN), or Flag empty vector for 48 h under normoxic conditions. Cells were then treated with or without 30 μM MG149 for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( C ) HEK293T cells were transfected with Flag-Tip60, Flag-Tip60-DN, or Flag empty vector for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were cultured under normoxic or hypoxic conditions for 24 h. WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were cultured under normoxic conditions. Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( F ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp). Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp) or not (Nor). Cells were then treated with or without 25 μM MG132 for another 12 h. Co-IP assays were performed with anti-β-TrCP1 antibodies followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( H ) GST-tagged Tip60 (GST-Tip60) and His6-tagged β-TrCP1 (His6-β-TrCP1) were purified from E. coli (left) and coincubated. His6 or GST pull-down analysis with Ni-beads or Sepharose 4B-beads was performed (right two panels). ( I ) In vitro acetylation assays were performed by incubating GST-Tip60 and His6-β-TrCP1 with or without acetyl coenzyme A (Ac-CoA). WB assays were performed with the indicated antibodies. ( J ) HEK293T cells transfected with HA-tagged β-TrCP1 (HA-β-TrCP1) together with Flag-Tip60 or Flag-Tip60-DN were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) together with Tip60-specific siRNA (siTip60: (+)) or control siRNA (siTip60: (-)) were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-Flag antibodies followed by WB analyses. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells were transfected with siTip60 or siCont. for 48 h. Cells were then treated with or without 25 μM MG132 and cultured under normoxic or hypoxic conditions for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with Flag-Tip60 or Flag empty vector for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) HEK293T cells were transfected with siTip60 or siCont. for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia
    Sirnas Against Tip60, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tip60+sirna/pmc12799899-401-1-33?v=Santa+Cruz+Biotechnology
    Average 93 stars, based on 1 article reviews
    sirnas against tip60 - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    90
    Thermo Fisher tip60 (kat5)-sirna assay id 110507
    <t>Tip60</t> is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia. ( A ) HEK293T cells were transfected with multiple HA- or Flag-tagged acetyltransferases or HA empty vector as indicated for 48 h under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were transfected with Flag-tagged wild-type Tip60 (Flag-Tip60), the dominant negative (DN) mutant lacking the enzymatic activity of Tip60 (Flag-Tip60-DN), or Flag empty vector for 48 h under normoxic conditions. Cells were then treated with or without 30 μM MG149 for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( C ) HEK293T cells were transfected with Flag-Tip60, Flag-Tip60-DN, or Flag empty vector for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were cultured under normoxic or hypoxic conditions for 24 h. WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were cultured under normoxic conditions. Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( F ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp). Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp) or not (Nor). Cells were then treated with or without 25 μM MG132 for another 12 h. Co-IP assays were performed with anti-β-TrCP1 antibodies followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( H ) GST-tagged Tip60 (GST-Tip60) and His6-tagged β-TrCP1 (His6-β-TrCP1) were purified from E. coli (left) and coincubated. His6 or GST pull-down analysis with Ni-beads or Sepharose 4B-beads was performed (right two panels). ( I ) In vitro acetylation assays were performed by incubating GST-Tip60 and His6-β-TrCP1 with or without acetyl coenzyme A (Ac-CoA). WB assays were performed with the indicated antibodies. ( J ) HEK293T cells transfected with HA-tagged β-TrCP1 (HA-β-TrCP1) together with Flag-Tip60 or Flag-Tip60-DN were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) together with Tip60-specific siRNA (siTip60: (+)) or control siRNA (siTip60: (-)) were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-Flag antibodies followed by WB analyses. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells were transfected with siTip60 or siCont. for 48 h. Cells were then treated with or without 25 μM MG132 and cultured under normoxic or hypoxic conditions for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with Flag-Tip60 or Flag empty vector for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) HEK293T cells were transfected with siTip60 or siCont. for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia
    Tip60 (Kat5) Sirna Assay Id 110507, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tip60+sirna/pm38184505-62-0-14?v=Thermo+Fisher
    Average 90 stars, based on 1 article reviews
    tip60 (kat5)-sirna assay id 110507 - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology tip60
    <t>Tip60</t> is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia. ( A ) HEK293T cells were transfected with multiple HA- or Flag-tagged acetyltransferases or HA empty vector as indicated for 48 h under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were transfected with Flag-tagged wild-type Tip60 (Flag-Tip60), the dominant negative (DN) mutant lacking the enzymatic activity of Tip60 (Flag-Tip60-DN), or Flag empty vector for 48 h under normoxic conditions. Cells were then treated with or without 30 μM MG149 for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( C ) HEK293T cells were transfected with Flag-Tip60, Flag-Tip60-DN, or Flag empty vector for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were cultured under normoxic or hypoxic conditions for 24 h. WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were cultured under normoxic conditions. Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( F ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp). Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp) or not (Nor). Cells were then treated with or without 25 μM MG132 for another 12 h. Co-IP assays were performed with anti-β-TrCP1 antibodies followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( H ) GST-tagged Tip60 (GST-Tip60) and His6-tagged β-TrCP1 (His6-β-TrCP1) were purified from E. coli (left) and coincubated. His6 or GST pull-down analysis with Ni-beads or Sepharose 4B-beads was performed (right two panels). ( I ) In vitro acetylation assays were performed by incubating GST-Tip60 and His6-β-TrCP1 with or without acetyl coenzyme A (Ac-CoA). WB assays were performed with the indicated antibodies. ( J ) HEK293T cells transfected with HA-tagged β-TrCP1 (HA-β-TrCP1) together with Flag-Tip60 or Flag-Tip60-DN were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) together with Tip60-specific siRNA (siTip60: (+)) or control siRNA (siTip60: (-)) were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-Flag antibodies followed by WB analyses. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells were transfected with siTip60 or siCont. for 48 h. Cells were then treated with or without 25 μM MG132 and cultured under normoxic or hypoxic conditions for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with Flag-Tip60 or Flag empty vector for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) HEK293T cells were transfected with siTip60 or siCont. for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia
    Tip60, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tip60+sirna/pm38093659-73-98-123?v=Santa+Cruz+Biotechnology
    Average 93 stars, based on 1 article reviews
    tip60 - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology tip60 sirna
    <t>Tip60</t> is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia. ( A ) HEK293T cells were transfected with multiple HA- or Flag-tagged acetyltransferases or HA empty vector as indicated for 48 h under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were transfected with Flag-tagged wild-type Tip60 (Flag-Tip60), the dominant negative (DN) mutant lacking the enzymatic activity of Tip60 (Flag-Tip60-DN), or Flag empty vector for 48 h under normoxic conditions. Cells were then treated with or without 30 μM MG149 for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( C ) HEK293T cells were transfected with Flag-Tip60, Flag-Tip60-DN, or Flag empty vector for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were cultured under normoxic or hypoxic conditions for 24 h. WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were cultured under normoxic conditions. Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( F ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp). Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp) or not (Nor). Cells were then treated with or without 25 μM MG132 for another 12 h. Co-IP assays were performed with anti-β-TrCP1 antibodies followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( H ) GST-tagged Tip60 (GST-Tip60) and His6-tagged β-TrCP1 (His6-β-TrCP1) were purified from E. coli (left) and coincubated. His6 or GST pull-down analysis with Ni-beads or Sepharose 4B-beads was performed (right two panels). ( I ) In vitro acetylation assays were performed by incubating GST-Tip60 and His6-β-TrCP1 with or without acetyl coenzyme A (Ac-CoA). WB assays were performed with the indicated antibodies. ( J ) HEK293T cells transfected with HA-tagged β-TrCP1 (HA-β-TrCP1) together with Flag-Tip60 or Flag-Tip60-DN were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) together with Tip60-specific siRNA (siTip60: (+)) or control siRNA (siTip60: (-)) were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-Flag antibodies followed by WB analyses. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells were transfected with siTip60 or siCont. for 48 h. Cells were then treated with or without 25 μM MG132 and cultured under normoxic or hypoxic conditions for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with Flag-Tip60 or Flag empty vector for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) HEK293T cells were transfected with siTip60 or siCont. for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia
    Tip60 Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tip60+sirna/pm37739936-546-53-66?v=Santa+Cruz+Biotechnology
    Average 93 stars, based on 1 article reviews
    tip60 sirna - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    93
    Santa Cruz Biotechnology 5ʹ accaccctgttgctgtagccaa 3ʹ
    <t>Tip60</t> is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia. ( A ) HEK293T cells were transfected with multiple HA- or Flag-tagged acetyltransferases or HA empty vector as indicated for 48 h under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were transfected with Flag-tagged wild-type Tip60 (Flag-Tip60), the dominant negative (DN) mutant lacking the enzymatic activity of Tip60 (Flag-Tip60-DN), or Flag empty vector for 48 h under normoxic conditions. Cells were then treated with or without 30 μM MG149 for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( C ) HEK293T cells were transfected with Flag-Tip60, Flag-Tip60-DN, or Flag empty vector for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were cultured under normoxic or hypoxic conditions for 24 h. WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were cultured under normoxic conditions. Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( F ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp). Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp) or not (Nor). Cells were then treated with or without 25 μM MG132 for another 12 h. Co-IP assays were performed with anti-β-TrCP1 antibodies followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( H ) GST-tagged Tip60 (GST-Tip60) and His6-tagged β-TrCP1 (His6-β-TrCP1) were purified from E. coli (left) and coincubated. His6 or GST pull-down analysis with Ni-beads or Sepharose 4B-beads was performed (right two panels). ( I ) In vitro acetylation assays were performed by incubating GST-Tip60 and His6-β-TrCP1 with or without acetyl coenzyme A (Ac-CoA). WB assays were performed with the indicated antibodies. ( J ) HEK293T cells transfected with HA-tagged β-TrCP1 (HA-β-TrCP1) together with Flag-Tip60 or Flag-Tip60-DN were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) together with Tip60-specific siRNA (siTip60: (+)) or control siRNA (siTip60: (-)) were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-Flag antibodies followed by WB analyses. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells were transfected with siTip60 or siCont. for 48 h. Cells were then treated with or without 25 μM MG132 and cultured under normoxic or hypoxic conditions for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with Flag-Tip60 or Flag empty vector for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) HEK293T cells were transfected with siTip60 or siCont. for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia
    5ʹ Accaccctgttgctgtagccaa 3ʹ, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/tip60+sirna/pm37739936-546-52-66?v=Santa+Cruz+Biotechnology
    Average 93 stars, based on 1 article reviews
    5ʹ accaccctgttgctgtagccaa 3ʹ - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia. ( A ) HEK293T cells were transfected with multiple HA- or Flag-tagged acetyltransferases or HA empty vector as indicated for 48 h under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were transfected with Flag-tagged wild-type Tip60 (Flag-Tip60), the dominant negative (DN) mutant lacking the enzymatic activity of Tip60 (Flag-Tip60-DN), or Flag empty vector for 48 h under normoxic conditions. Cells were then treated with or without 30 μM MG149 for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( C ) HEK293T cells were transfected with Flag-Tip60, Flag-Tip60-DN, or Flag empty vector for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were cultured under normoxic or hypoxic conditions for 24 h. WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were cultured under normoxic conditions. Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( F ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp). Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp) or not (Nor). Cells were then treated with or without 25 μM MG132 for another 12 h. Co-IP assays were performed with anti-β-TrCP1 antibodies followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( H ) GST-tagged Tip60 (GST-Tip60) and His6-tagged β-TrCP1 (His6-β-TrCP1) were purified from E. coli (left) and coincubated. His6 or GST pull-down analysis with Ni-beads or Sepharose 4B-beads was performed (right two panels). ( I ) In vitro acetylation assays were performed by incubating GST-Tip60 and His6-β-TrCP1 with or without acetyl coenzyme A (Ac-CoA). WB assays were performed with the indicated antibodies. ( J ) HEK293T cells transfected with HA-tagged β-TrCP1 (HA-β-TrCP1) together with Flag-Tip60 or Flag-Tip60-DN were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) together with Tip60-specific siRNA (siTip60: (+)) or control siRNA (siTip60: (-)) were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-Flag antibodies followed by WB analyses. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells were transfected with siTip60 or siCont. for 48 h. Cells were then treated with or without 25 μM MG132 and cultured under normoxic or hypoxic conditions for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with Flag-Tip60 or Flag empty vector for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) HEK293T cells were transfected with siTip60 or siCont. for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia

    Journal: Cellular and Molecular Life Sciences: CMLS

    Article Title: Tip60-HDAC8-SMURF2-mediated β-TrCP1 degradation is a key mechanism for hypoxia-induced cell death and tissue injury

    doi: 10.1007/s00018-025-05983-4

    Figure Lengend Snippet: Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia. ( A ) HEK293T cells were transfected with multiple HA- or Flag-tagged acetyltransferases or HA empty vector as indicated for 48 h under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were transfected with Flag-tagged wild-type Tip60 (Flag-Tip60), the dominant negative (DN) mutant lacking the enzymatic activity of Tip60 (Flag-Tip60-DN), or Flag empty vector for 48 h under normoxic conditions. Cells were then treated with or without 30 μM MG149 for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( C ) HEK293T cells were transfected with Flag-Tip60, Flag-Tip60-DN, or Flag empty vector for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were cultured under normoxic or hypoxic conditions for 24 h. WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were cultured under normoxic conditions. Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( F ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp). Co-IP assays were performed with anti-β-TrCP1 or anti-Tip60 antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were exposed to 1% O 2 for 24 h (Hyp) or not (Nor). Cells were then treated with or without 25 μM MG132 for another 12 h. Co-IP assays were performed with anti-β-TrCP1 antibodies followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( H ) GST-tagged Tip60 (GST-Tip60) and His6-tagged β-TrCP1 (His6-β-TrCP1) were purified from E. coli (left) and coincubated. His6 or GST pull-down analysis with Ni-beads or Sepharose 4B-beads was performed (right two panels). ( I ) In vitro acetylation assays were performed by incubating GST-Tip60 and His6-β-TrCP1 with or without acetyl coenzyme A (Ac-CoA). WB assays were performed with the indicated antibodies. ( J ) HEK293T cells transfected with HA-tagged β-TrCP1 (HA-β-TrCP1) together with Flag-Tip60 or Flag-Tip60-DN were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) together with Tip60-specific siRNA (siTip60: (+)) or control siRNA (siTip60: (-)) were challenged with 1% O 2 for 24 h or not. Co-IP assays were performed with anti-Flag antibodies followed by WB analyses. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells were transfected with siTip60 or siCont. for 48 h. Cells were then treated with or without 25 μM MG132 and cultured under normoxic or hypoxic conditions for another 12 h. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with Flag-Tip60 or Flag empty vector for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) HEK293T cells were transfected with siTip60 or siCont. for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 is the acetyltransferase of β-TrCP1, and Tip60-mediated β-TrCP1 acetylation is impaired upon hypoxia

    Article Snippet: The siRNAs against Tip60 (sc-37966), SMURF2 (sc-41675), HDAC1 (sc-44208), HDAC2 (sc-29345), HDAC3 (sc-35538), HDAC4 (sc-35540), HDAC5 (sc-35542), HDAC6 (sc-35544), HDAC7 (sc-35546), HDAC8 (sc-35548), HDAC9 (sc-35550), HDAC10 (sc-72307) and HDAC11 (sc-106896) were purchased from Santa Cruz Biotechnology (USA).

    Techniques: Transfection, Plasmid Preparation, Dominant Negative Mutation, Mutagenesis, Activity Assay, Cell Culture, Co-Immunoprecipitation Assay, Negative Control, Purification, In Vitro, Control

    K96 and K294 are the acetylation sites of β-TrCP1 that are regulated by Tip60 and HDAC8 and are responsible for hypoxia-induced β-TrCP1 degradation. ( A ) LC–MS/MS analysis of Flag-tagged β-TrCP1 identified K96, K220, and K294 as potential β-TrCP1 acetylation sites. MS spectra of the peptides containing the three acetylation sites are shown. ( B ) Prediction of potential acetylation sites of β-TrCP1 using the GPS-PAIL database ( http://pail.biocuckoo.org/ ). ( C ) HEK293T cells transfected with Flag-tagged wild-type (WT) β-TrCP1 or seven lysine (K) to alanine (A)-mutated β-TrCP1 were challenged with 1% O 2 for 24 h (Hyp) or not (Nor) combined with (+) or without (-) 10 μM TSA for 12 h as indicated. WB assays were performed with the indicated antibodies. ( D ) HEK293T cells were transfected with Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( E ) Alignment of the K96- and K294-containing peptide sequences from distinct species. ( F ) Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 combined with (+) or without (-) HA-tagged Tip60 (HA-Tip60) as indicated was transfected into HEK293T cells for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( G ) Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 combined with (+) or without (-) HDAC8-specific siRNA (siHDAC8) as indicated was transfected into HEK293T cells for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( H ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (Flag-β-TrCP1-WT) or K96A- or K294A-mutated β-TrCP1 (Flag-β-TrCP1-K96A and Flag-β-TrCP1-K294A) for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( I ) K to glutamine (Q) mutations at the K96 and K294 sites of β-TrCP1 were generated. HEK293T cells were transfected with Flag-β-TrCP1-WT, Flag-tagged K96Q- or K294Q-mutated β-TrCP1 (Flag-β-TrCP1-K96Q and Flag-β-TrCP1-K294Q) for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( J ) HEK293T cells were transfected with WT or K96A-, K294A-, K96Q-, or K294Q-mutated Flag-β-TrCP1 for 48 h. Cells were then cultured under hypoxic conditions (Hyp) for 24 h combined with 25 μM MG132 treatment for 12 h. Cells were subsequently lysed under denaturing conditions, and β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analysis. ( K ) HEK293T cells transfected with WT or K96A-, K294A-, K96Q-, or K294Q-, or double KA- or KQ-mutated Flag-β-TrCP1 were challenged with 1% O 2 for 24 h (Hyp) or not (Nor) as indicated. WB assays were performed to measure the levels of the indicated proteins. ( L ) WT or K96A-, K2 22 94A-, or double KA-mutated Flag-β-TrCP1 together with (+) or without (-) siHDAC8 were transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor) as indicated. WB assays were performed to measure the levels of the indicated proteins. ( M ) WT or seven KA-mutated Flag-β-TrCP1 together with (+) or without (-) HA-Tip60 were transfected into HEK293T cells under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( N) WT or K96A- or K294A-mutated Flag-β-TrCP1 together with (+) or without (-) HA-Tip60 were transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp). WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 mainly regulates the acetylation of β-TrCP1 at K294, whereas HDAC8 can eliminate the acetylation of β-TrCP1 at both K96 and K294

    Journal: Cellular and Molecular Life Sciences: CMLS

    Article Title: Tip60-HDAC8-SMURF2-mediated β-TrCP1 degradation is a key mechanism for hypoxia-induced cell death and tissue injury

    doi: 10.1007/s00018-025-05983-4

    Figure Lengend Snippet: K96 and K294 are the acetylation sites of β-TrCP1 that are regulated by Tip60 and HDAC8 and are responsible for hypoxia-induced β-TrCP1 degradation. ( A ) LC–MS/MS analysis of Flag-tagged β-TrCP1 identified K96, K220, and K294 as potential β-TrCP1 acetylation sites. MS spectra of the peptides containing the three acetylation sites are shown. ( B ) Prediction of potential acetylation sites of β-TrCP1 using the GPS-PAIL database ( http://pail.biocuckoo.org/ ). ( C ) HEK293T cells transfected with Flag-tagged wild-type (WT) β-TrCP1 or seven lysine (K) to alanine (A)-mutated β-TrCP1 were challenged with 1% O 2 for 24 h (Hyp) or not (Nor) combined with (+) or without (-) 10 μM TSA for 12 h as indicated. WB assays were performed with the indicated antibodies. ( D ) HEK293T cells were transfected with Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( E ) Alignment of the K96- and K294-containing peptide sequences from distinct species. ( F ) Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 combined with (+) or without (-) HA-tagged Tip60 (HA-Tip60) as indicated was transfected into HEK293T cells for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( G ) Flag-tagged wild-type (WT) β-TrCP1 or K96A- or K294A-mutated β-TrCP1 combined with (+) or without (-) HDAC8-specific siRNA (siHDAC8) as indicated was transfected into HEK293T cells for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( H ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (Flag-β-TrCP1-WT) or K96A- or K294A-mutated β-TrCP1 (Flag-β-TrCP1-K96A and Flag-β-TrCP1-K294A) for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( I ) K to glutamine (Q) mutations at the K96 and K294 sites of β-TrCP1 were generated. HEK293T cells were transfected with Flag-β-TrCP1-WT, Flag-tagged K96Q- or K294Q-mutated β-TrCP1 (Flag-β-TrCP1-K96Q and Flag-β-TrCP1-K294Q) for 48 h under normoxic conditions. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( J ) HEK293T cells were transfected with WT or K96A-, K294A-, K96Q-, or K294Q-mutated Flag-β-TrCP1 for 48 h. Cells were then cultured under hypoxic conditions (Hyp) for 24 h combined with 25 μM MG132 treatment for 12 h. Cells were subsequently lysed under denaturing conditions, and β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analysis. ( K ) HEK293T cells transfected with WT or K96A-, K294A-, K96Q-, or K294Q-, or double KA- or KQ-mutated Flag-β-TrCP1 were challenged with 1% O 2 for 24 h (Hyp) or not (Nor) as indicated. WB assays were performed to measure the levels of the indicated proteins. ( L ) WT or K96A-, K2 22 94A-, or double KA-mutated Flag-β-TrCP1 together with (+) or without (-) siHDAC8 were transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor) as indicated. WB assays were performed to measure the levels of the indicated proteins. ( M ) WT or seven KA-mutated Flag-β-TrCP1 together with (+) or without (-) HA-Tip60 were transfected into HEK293T cells under normoxic conditions. WB assays were performed to measure the levels of the indicated proteins. ( N) WT or K96A- or K294A-mutated Flag-β-TrCP1 together with (+) or without (-) HA-Tip60 were transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp). WB assays were performed to measure the levels of the indicated proteins. ( O ) Working model. Tip60 mainly regulates the acetylation of β-TrCP1 at K294, whereas HDAC8 can eliminate the acetylation of β-TrCP1 at both K96 and K294

    Article Snippet: The siRNAs against Tip60 (sc-37966), SMURF2 (sc-41675), HDAC1 (sc-44208), HDAC2 (sc-29345), HDAC3 (sc-35538), HDAC4 (sc-35540), HDAC5 (sc-35542), HDAC6 (sc-35544), HDAC7 (sc-35546), HDAC8 (sc-35548), HDAC9 (sc-35550), HDAC10 (sc-72307) and HDAC11 (sc-106896) were purchased from Santa Cruz Biotechnology (USA).

    Techniques: Liquid Chromatography with Mass Spectroscopy, Transfection, Co-Immunoprecipitation Assay, Negative Control, Generated, Cell Culture, Immunoprecipitation

    SMURF2 is the E3 ubiquitin ligase for β-TrCP1 and is essential for hypoxia-induced β-TrCP1 degradation. ( A ) HEK293T cells were transfected with control siRNA (siCont.) or siRNAs specific for the indicated genes for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( B ) Myc-tagged wild-type (WT) SMURF2 or Myc-tagged C716A-mutated SMURF2 lacking enzymatic activity or Myc empty vector was transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( C ) Myc-tagged SMURF2 or Myc empty vector was transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor) and treated with (+) or without (-) 25 μM MG132 for 12 h. WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) and Myc-SMURF2 for 48 h. Cells were challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( E ) Flag-β-TrCP1 and His-tagged ubiquitin (His-ubiquitin) were cotransfected with or without Myc-SMURF2 into HEK293T cells for 48 h. Cells were then treated with 25 mM MG132 and cultured under normoxic or hypoxic conditions for another 24 h. Cells were lysed under denaturing conditions, and Flag-β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analyses. ( F ) Flag-β-TrCP1 and His-ubiquitin were cotransfected with or without SMURF2-specific siRNA (siSMURF2) into HEK293T cells for 48 h. Cells were then treated with 25 mM MG132 and cultured under normoxic or hypoxic conditions for another 24 h. Cells were lysed under denaturing conditions, and Flag-β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analyses. ( G and H ) HEK293T cells were transfected with Myc-SMURF2 or Myc empty vector for 48 h. Cells were cultured under normoxic or hypoxic conditions for another 24 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( I and J ) HEK293T cells were transfected with siSMURF2 or control siRNA (siCont.) for 48 h. Cells were cultured under normoxic or hypoxic conditions for another 24 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( K ) HEK293T cells transfected with Flag-β-TrCP1 and Myc-SMURF2 combined with (+) or without (-) siHDAC8 were challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells transfected with Flag-β-TrCP1 and Myc-SMURF2 combined with (+) or without (-) HA-Tip60 were challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( M ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (WT) or Flag-tagged K96A- or K294A-mutated β-TrCP1 (K96A- or K294A) combined with Myc-SMURF2 for 48 h. Cells were then challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( N ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (WT) or Flag-tagged K96Q- or K294Q-mutated β-TrCP1 (K96Q- or K294Q) combined with Myc-SMURF2 for 48 h. Cells were then challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( O ) WT or the K96Q- or K294Q-mutated Flag-β-TrCP1 together with (+) or without (-) Myc-tagged SMURF2 (Myc-SMURF2) were transfected into HEK293T cells for 24 h. Cells were then exposed to 1% O 2 for 12 h (Hyp) or not (Nor). Cell extracts were prepared, and WB assays were performed to measure the levels of the indicated proteins. ( P ) WT or K96A- or K294A-mutated Flag-β-TrCP1 together with (+) or without (-) Myc-tagged SMURF2 (Myc-SMURF2) were transfected into HEK293T cells for 24 h. Cells were then exposed to 1% O 2 for 12 h (Hyp) or not (Nor). Cell extracts were prepared, and WB assays were performed to measure the levels of the indicated proteins

    Journal: Cellular and Molecular Life Sciences: CMLS

    Article Title: Tip60-HDAC8-SMURF2-mediated β-TrCP1 degradation is a key mechanism for hypoxia-induced cell death and tissue injury

    doi: 10.1007/s00018-025-05983-4

    Figure Lengend Snippet: SMURF2 is the E3 ubiquitin ligase for β-TrCP1 and is essential for hypoxia-induced β-TrCP1 degradation. ( A ) HEK293T cells were transfected with control siRNA (siCont.) or siRNAs specific for the indicated genes for 48 h. Cells were then challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( B ) Myc-tagged wild-type (WT) SMURF2 or Myc-tagged C716A-mutated SMURF2 lacking enzymatic activity or Myc empty vector was transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( C ) Myc-tagged SMURF2 or Myc empty vector was transfected into HEK293T cells. Cells were then challenged with 1% O 2 for 24 h (Hyp) or not (Nor) and treated with (+) or without (-) 25 μM MG132 for 12 h. WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were transfected with Flag-tagged β-TrCP1 (Flag-β-TrCP1) and Myc-SMURF2 for 48 h. Cells were challenged with 1% O 2 for another 24 h (Hyp) or not (Nor). Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( E ) Flag-β-TrCP1 and His-tagged ubiquitin (His-ubiquitin) were cotransfected with or without Myc-SMURF2 into HEK293T cells for 48 h. Cells were then treated with 25 mM MG132 and cultured under normoxic or hypoxic conditions for another 24 h. Cells were lysed under denaturing conditions, and Flag-β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analyses. ( F ) Flag-β-TrCP1 and His-ubiquitin were cotransfected with or without SMURF2-specific siRNA (siSMURF2) into HEK293T cells for 48 h. Cells were then treated with 25 mM MG132 and cultured under normoxic or hypoxic conditions for another 24 h. Cells were lysed under denaturing conditions, and Flag-β-TrCP1 was immunoprecipitated (IP) with anti-Flag antibodies. IP with IgG was performed as a negative control. The precipitated proteins were subjected to WB analyses. ( G and H ) HEK293T cells were transfected with Myc-SMURF2 or Myc empty vector for 48 h. Cells were cultured under normoxic or hypoxic conditions for another 24 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( I and J ) HEK293T cells were transfected with siSMURF2 or control siRNA (siCont.) for 48 h. Cells were cultured under normoxic or hypoxic conditions for another 24 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( K ) HEK293T cells transfected with Flag-β-TrCP1 and Myc-SMURF2 combined with (+) or without (-) siHDAC8 were challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( L ) HEK293T cells transfected with Flag-β-TrCP1 and Myc-SMURF2 combined with (+) or without (-) HA-Tip60 were challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( M ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (WT) or Flag-tagged K96A- or K294A-mutated β-TrCP1 (K96A- or K294A) combined with Myc-SMURF2 for 48 h. Cells were then challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( N ) HEK293T cells were transfected with Flag-tagged wild-type β-TrCP1 (WT) or Flag-tagged K96Q- or K294Q-mutated β-TrCP1 (K96Q- or K294Q) combined with Myc-SMURF2 for 48 h. Cells were then challenged with hypoxia (+) or not (-) and treated with 25 μM MG132 for 12 h. Co-IP assays were performed with anti-Myc antibodies, followed by WB analyses to measure the levels of the indicated proteins. Co-IP with IgG was performed as a negative control. ( O ) WT or the K96Q- or K294Q-mutated Flag-β-TrCP1 together with (+) or without (-) Myc-tagged SMURF2 (Myc-SMURF2) were transfected into HEK293T cells for 24 h. Cells were then exposed to 1% O 2 for 12 h (Hyp) or not (Nor). Cell extracts were prepared, and WB assays were performed to measure the levels of the indicated proteins. ( P ) WT or K96A- or K294A-mutated Flag-β-TrCP1 together with (+) or without (-) Myc-tagged SMURF2 (Myc-SMURF2) were transfected into HEK293T cells for 24 h. Cells were then exposed to 1% O 2 for 12 h (Hyp) or not (Nor). Cell extracts were prepared, and WB assays were performed to measure the levels of the indicated proteins

    Article Snippet: The siRNAs against Tip60 (sc-37966), SMURF2 (sc-41675), HDAC1 (sc-44208), HDAC2 (sc-29345), HDAC3 (sc-35538), HDAC4 (sc-35540), HDAC5 (sc-35542), HDAC6 (sc-35544), HDAC7 (sc-35546), HDAC8 (sc-35548), HDAC9 (sc-35550), HDAC10 (sc-72307) and HDAC11 (sc-106896) were purchased from Santa Cruz Biotechnology (USA).

    Techniques: Ubiquitin Proteomics, Transfection, Control, Activity Assay, Plasmid Preparation, Co-Immunoprecipitation Assay, Negative Control, Cell Culture, Immunoprecipitation

    Tip60 is prolyl-hydroxylated and stabilized by PHD2. ( A ) HEK293T cells were treated with 300 μM CoCl 2 (left) or 20 μM IOX2 (right) for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were treated with 300 μM CoCl 2 (upper) or 20 μM IOX2 (lower) for 12 h. Quantitative RT-PCR assays were performed to detect the mRNA levels of Tip60 and β-TrCP1. ( C ) HEK293T cells were treated with 300 μM CoCl 2 or 20 μM IOX2 together with or without 25 μM MG132 for 12 h. WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were transfected with increasing amounts of Flag-tagged PHD2 (Flag-PHD2) for 48 h. Cells were then exposed to 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were transfected with PHD2-specific siRNA (siPHD2) or control siRNA (siCont.) for 48 h. Cells were then exposed in 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to detect the levels of the indicated proteins. ( F ) HEK293T cells were transfected with Flag-PHD2 and HA-tagged Tip60 (HA-Tip60) for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag (upper) or anti-HA (lower) antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were transfected with HA-Tip60 combined with (+) or without (-) Flag-PHD2 or siPHD2 as indicated for 48 h under normoxic conditions. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( H ) HEK293T cells were transfected with Flag-tagged Tip60 (Flag-Tip60) for 48 h under normoxic conditions. Cells were then treated with 300 μM CoCl 2 or 20 μM IOX2 for the indicated times. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( I ) HEK293T cells were transfected with wild-type (WT) Flag-Tip60 and its eight P to alanine (A) mutants under normoxic conditions for 48 h. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( J ) WT or P159A- or P374A-mutated Flag-Tip60 were cotransfected with (+) or without (-) HA-tagged PHD2 (HA-PHD2) into HEK293T cells under normoxic conditions for 48 h. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells were transfected with siPHD2 or siCont. for 48 h. Cells were then cultured under normoxic (Nor) or hypoxic (Hyp) conditions for another 12 h together with or without 25 μM MG132 treatment as indicated. WB assays were performed to measure the levels of the indicated proteins. ( L ) HEK293T cells were transfected with Flag-PHD2 or Flag empty vector (upper) or siPHD2 or siCont. (lower) under normoxic conditions for 48 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with WT Flag-Tip60 (Flag-Tip60-WT) or P159A- or P374A-mutated Tip60 (Flag-Tip60-P159A and Flag-Tip60-P374A) under normoxic conditions for 48 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) Flag-Tip60-transfected HEK293T cells were challenged with 1% O 2 (Hyp) for the indicated times. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( O ) Working model. Tip60 is prolyl-hydroxylated and stabilized by PHD2 under normoxic conditions, whereas hypoxia decreases the prolyl hydroxylation of Tip60 and destabilizes Tip60

    Journal: Cellular and Molecular Life Sciences: CMLS

    Article Title: Tip60-HDAC8-SMURF2-mediated β-TrCP1 degradation is a key mechanism for hypoxia-induced cell death and tissue injury

    doi: 10.1007/s00018-025-05983-4

    Figure Lengend Snippet: Tip60 is prolyl-hydroxylated and stabilized by PHD2. ( A ) HEK293T cells were treated with 300 μM CoCl 2 (left) or 20 μM IOX2 (right) for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( B ) HEK293T cells were treated with 300 μM CoCl 2 (upper) or 20 μM IOX2 (lower) for 12 h. Quantitative RT-PCR assays were performed to detect the mRNA levels of Tip60 and β-TrCP1. ( C ) HEK293T cells were treated with 300 μM CoCl 2 or 20 μM IOX2 together with or without 25 μM MG132 for 12 h. WB assays were performed to measure the levels of the indicated proteins. ( D ) HEK293T cells were transfected with increasing amounts of Flag-tagged PHD2 (Flag-PHD2) for 48 h. Cells were then exposed to 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( E ) HEK293T cells were transfected with PHD2-specific siRNA (siPHD2) or control siRNA (siCont.) for 48 h. Cells were then exposed in 1% O 2 for another 24 h (Hyp) or not (Nor). WB assays were performed to detect the levels of the indicated proteins. ( F ) HEK293T cells were transfected with Flag-PHD2 and HA-tagged Tip60 (HA-Tip60) for 48 h under normoxic conditions. Co-IP assays were performed with anti-Flag (upper) or anti-HA (lower) antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( G ) HEK293T cells were transfected with HA-Tip60 combined with (+) or without (-) Flag-PHD2 or siPHD2 as indicated for 48 h under normoxic conditions. Co-IP assays were performed with anti-HA antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( H ) HEK293T cells were transfected with Flag-tagged Tip60 (Flag-Tip60) for 48 h under normoxic conditions. Cells were then treated with 300 μM CoCl 2 or 20 μM IOX2 for the indicated times. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( I ) HEK293T cells were transfected with wild-type (WT) Flag-Tip60 and its eight P to alanine (A) mutants under normoxic conditions for 48 h. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( J ) WT or P159A- or P374A-mutated Flag-Tip60 were cotransfected with (+) or without (-) HA-tagged PHD2 (HA-PHD2) into HEK293T cells under normoxic conditions for 48 h. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( K ) HEK293T cells were transfected with siPHD2 or siCont. for 48 h. Cells were then cultured under normoxic (Nor) or hypoxic (Hyp) conditions for another 12 h together with or without 25 μM MG132 treatment as indicated. WB assays were performed to measure the levels of the indicated proteins. ( L ) HEK293T cells were transfected with Flag-PHD2 or Flag empty vector (upper) or siPHD2 or siCont. (lower) under normoxic conditions for 48 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( M ) HEK293T cells were transfected with WT Flag-Tip60 (Flag-Tip60-WT) or P159A- or P374A-mutated Tip60 (Flag-Tip60-P159A and Flag-Tip60-P374A) under normoxic conditions for 48 h. Chase assays were performed by treating cells with 50 μg/mL CHX for the indicated times. WB assays were performed to measure the levels of the indicated proteins. ( N ) Flag-Tip60-transfected HEK293T cells were challenged with 1% O 2 (Hyp) for the indicated times. Co-IP assays were performed with anti-Flag antibodies, followed by WB analyses. Co-IP with IgG was performed as a negative control. ( O ) Working model. Tip60 is prolyl-hydroxylated and stabilized by PHD2 under normoxic conditions, whereas hypoxia decreases the prolyl hydroxylation of Tip60 and destabilizes Tip60

    Article Snippet: The siRNAs against Tip60 (sc-37966), SMURF2 (sc-41675), HDAC1 (sc-44208), HDAC2 (sc-29345), HDAC3 (sc-35538), HDAC4 (sc-35540), HDAC5 (sc-35542), HDAC6 (sc-35544), HDAC7 (sc-35546), HDAC8 (sc-35548), HDAC9 (sc-35550), HDAC10 (sc-72307) and HDAC11 (sc-106896) were purchased from Santa Cruz Biotechnology (USA).

    Techniques: Quantitative RT-PCR, Transfection, Control, Co-Immunoprecipitation Assay, Negative Control, Cell Culture, Plasmid Preparation

    β-TrCP1 degradation is required for hypoxia-induced cell death and tissue injury. ( A ) HepG2 cells were transfected with siHDAC8 or siHDAC8 combined with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( B ) HepG2 cells were transfected with Flag-Tip60 or Flag-Tip60 combined with siβ-TrCP1 or Flag empty vector for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( C ) HepG2 cells were transfected with wild-type (WT) or K96Q- or K294Q-mutated Flag-β-TrCP1 for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( D ) HepG2 cells were transfected with siSMURF2 or siSMUFR2 combined with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( E ) HepG2 cells were transfected with Flag-β-TrCP1 or Flag empty vector for 24 h. Cells were then exposed to 1% O 2 for 72 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( F ) HepG2 cells were transfected with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 for 72 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( G ) HepG2 cells were transfected with siβ-TrCP1, siβ-TrCP1 together with p53-specific siRNA (sip53), or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times or not (Nor). Cell death was measured by PI staining assay. ( H ) HepG2 cells were transfected with HA-tagged β-TrCP1 (HA-β-TrCP1), HA-β-TrCP1 together with Flag-tagged p53 (Flag-p53), or Flag empty vector (Cont.) for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times or not (Nor). Cell death was measured by PI staining assay. ( I ) Wild-type (WT), Tip60-specific shRNA (shTip60)-containing AAV8-infected or shTip60-AAV8 combined with Flag-β-TrCP1-containing AAV8-infected mice were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( J ) WT, shTip60-containing AAV8-infected or shTip60-AAV8 combined with Flag-β-TrCP1-containing AAV8-infected mice were exposed to Hyp for 72 h (+) or not (-) as indicated. Serum ALT and AST levels were measured ( n = 6). (K ) WT, β-TrCP1 −/− , and WT or β-TrCP1 −/− mice infected with HDAC8-specific shRNA (shHDAC8)-containing AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( L ) WT, β-TrCP1 −/− , and WT or β-TrCP1 −/− mice infected with shHDAC8-AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Serum ALT and AST levels were measured ( n = 6). ( M ) WT, β-TrCP1 −/− and β-TrCP1 −/− mice infected with p53-specific shRNA (shp53)-containing AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( N ) WT, β-TrCP1 −/− or β-TrCP1 −/− mice infected with shp53-containing AAV8 were exposed to Hyp for 72 h (+) or not (-) as indicated. Serum ALT, AST and bilirubin levels were measured ( n = 6). ( O ) Working model. Under normoxic conditions, Tip60 is prolyl-hydroxylated and stabilized by PHD2, and then Tip60 acetylates β-TrCP1 to stabilize β-TrCP1, allowing cells with lower levels of p53. Under hypoxic conditions, impaired prolyl hydroxylation of Tip60 results in the degradation of Tip60, and HDAC8 is recruited to β-TrCP1, synergistically promoting a decrease in β-TrCP1 acetylation. Thus, more SMURF2 is recruited to β-TrCP1 and ubiquitinates β-TrCP1 to promote its degradation. Ultimately, p53 is accumulated, and cell death occurs. Data information: Bars and error bars represent mean ± SD, n = 4 independent repeats in ( A - D and H ), n = 3 independent repeats in ( G ), n = 6 independent repeats in ( J and L ). Two-tailed unpaired Student’s t test was performed. * p < 0.05; ** p < 0.01; *** p < 0.001

    Journal: Cellular and Molecular Life Sciences: CMLS

    Article Title: Tip60-HDAC8-SMURF2-mediated β-TrCP1 degradation is a key mechanism for hypoxia-induced cell death and tissue injury

    doi: 10.1007/s00018-025-05983-4

    Figure Lengend Snippet: β-TrCP1 degradation is required for hypoxia-induced cell death and tissue injury. ( A ) HepG2 cells were transfected with siHDAC8 or siHDAC8 combined with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( B ) HepG2 cells were transfected with Flag-Tip60 or Flag-Tip60 combined with siβ-TrCP1 or Flag empty vector for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( C ) HepG2 cells were transfected with wild-type (WT) or K96Q- or K294Q-mutated Flag-β-TrCP1 for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( D ) HepG2 cells were transfected with siSMURF2 or siSMUFR2 combined with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times. Cell death was measured by PI staining assay. ( E ) HepG2 cells were transfected with Flag-β-TrCP1 or Flag empty vector for 24 h. Cells were then exposed to 1% O 2 for 72 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( F ) HepG2 cells were transfected with siβ-TrCP1 or siCont. for 24 h. Cells were then exposed to 1% O 2 for 72 h (Hyp) or not (Nor). WB assays were performed to measure the levels of the indicated proteins. ( G ) HepG2 cells were transfected with siβ-TrCP1, siβ-TrCP1 together with p53-specific siRNA (sip53), or siCont. for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times or not (Nor). Cell death was measured by PI staining assay. ( H ) HepG2 cells were transfected with HA-tagged β-TrCP1 (HA-β-TrCP1), HA-β-TrCP1 together with Flag-tagged p53 (Flag-p53), or Flag empty vector (Cont.) for 24 h. Cells were then exposed to 1% O 2 (Hyp) for the indicated times or not (Nor). Cell death was measured by PI staining assay. ( I ) Wild-type (WT), Tip60-specific shRNA (shTip60)-containing AAV8-infected or shTip60-AAV8 combined with Flag-β-TrCP1-containing AAV8-infected mice were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( J ) WT, shTip60-containing AAV8-infected or shTip60-AAV8 combined with Flag-β-TrCP1-containing AAV8-infected mice were exposed to Hyp for 72 h (+) or not (-) as indicated. Serum ALT and AST levels were measured ( n = 6). (K ) WT, β-TrCP1 −/− , and WT or β-TrCP1 −/− mice infected with HDAC8-specific shRNA (shHDAC8)-containing AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( L ) WT, β-TrCP1 −/− , and WT or β-TrCP1 −/− mice infected with shHDAC8-AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Serum ALT and AST levels were measured ( n = 6). ( M ) WT, β-TrCP1 −/− and β-TrCP1 −/− mice infected with p53-specific shRNA (shp53)-containing AAV8 were exposed to 7% O 2 for 72 h (Hyp) or not (Nor). Histological analyses of TUNEL, immunostaining for cleaved caspase 3 and H&E assays were performed on liver sections. DAPI staining was performed to detect the nuclei. ( N ) WT, β-TrCP1 −/− or β-TrCP1 −/− mice infected with shp53-containing AAV8 were exposed to Hyp for 72 h (+) or not (-) as indicated. Serum ALT, AST and bilirubin levels were measured ( n = 6). ( O ) Working model. Under normoxic conditions, Tip60 is prolyl-hydroxylated and stabilized by PHD2, and then Tip60 acetylates β-TrCP1 to stabilize β-TrCP1, allowing cells with lower levels of p53. Under hypoxic conditions, impaired prolyl hydroxylation of Tip60 results in the degradation of Tip60, and HDAC8 is recruited to β-TrCP1, synergistically promoting a decrease in β-TrCP1 acetylation. Thus, more SMURF2 is recruited to β-TrCP1 and ubiquitinates β-TrCP1 to promote its degradation. Ultimately, p53 is accumulated, and cell death occurs. Data information: Bars and error bars represent mean ± SD, n = 4 independent repeats in ( A - D and H ), n = 3 independent repeats in ( G ), n = 6 independent repeats in ( J and L ). Two-tailed unpaired Student’s t test was performed. * p < 0.05; ** p < 0.01; *** p < 0.001

    Article Snippet: The siRNAs against Tip60 (sc-37966), SMURF2 (sc-41675), HDAC1 (sc-44208), HDAC2 (sc-29345), HDAC3 (sc-35538), HDAC4 (sc-35540), HDAC5 (sc-35542), HDAC6 (sc-35544), HDAC7 (sc-35546), HDAC8 (sc-35548), HDAC9 (sc-35550), HDAC10 (sc-72307) and HDAC11 (sc-106896) were purchased from Santa Cruz Biotechnology (USA).

    Techniques: Transfection, Staining, Plasmid Preparation, shRNA, Infection, TUNEL Assay, Immunostaining, Two Tailed Test